Expression of MC4R and AgRP mRNAs in Arcuate Nucleus (ARC)

Countenance of melanocortin-4 receptor and agouti-akin peptide mRNAs in arcuate kernel duaccentuation hanker promise malnutrition of womanly ovariectomized rats

Abstract

Objective: Melanocortin-4 receptor (MC4R) and agouti-akin peptide (AgRP) are concerned in essence homeostasis in the rat. The lean of the give consider was to evaluate the countenance of MC4R and AgRP mRNAs in arcuate kernel (ARC) duaccentuation hanker promise malnutrition of womanly ovariectomized rats.

Materials and Modes: Twelve womanly ovariectomized rats were disjoined into couple resembling assemblages (n=6) of regular and unpopular cheer assemblages. Four ovariectomized rats were disunitedd as governs. Using developed-duration PCR, the referring-to countenances (compared to governs) of MC4R and AgRP mRNAs in the ARC of rats were compared betwixt twain cheer assemblages.

Results: The referring-to countenance of MC4R and AgRP mRNA in the ARC of womanly ovariectomized rats duaccentuation hanker promise malnutrition was excellent than those with regular cheer (P<0.05).

Conclusion: Fluctuates in the referring-to countenance plane of MC4R and AgRP mRNAs duaccentuation hanker promise malnutrition of rat involved a stimulatory role of MC4R and AgRP in predominant essence estimate in ARC of rat hypothalamus.

Keywords: Melanocortin-4 receptor, Agouti-akin peptide, Hypothalamus, Malnutrition, Rat

Introduction

Melanocortin-4 receptor (MC4R) is the similar receptor restraint α-melanocyte pungent hormindividual (α-MSH), a cleavage issue of proopiomelanocortin (POMC) which is plain in hypothalamic arcuate nuclei (ARC) neurons (1). This receptor belongs to the melanocotrin receptors and individual of the members of G protein-coupled receptors that strikeivates adenylate cyclase (2). MC4R neurons bear been observed in ARC, periventricular nuclei (PVN) and medial preoptic area (MPO) and preoptic area (POA) of hypothalamus of rats which these nuclei are concerned in rale craving (3-5). MC4R blockage characteristic an anorectic order in rat (6). Moreover, MC4R agonist suppresses stay intake when administered to rats and mice that withdrawal functional leptin receptors (7). Conversely, accessiblely government of a exceptive MC4R rival energeticly augmentationd stay intake in rats (7). Strikeivation of MC4R by agonists such as α-MSH prevents sustentation and causes impressiveness damage (3). In rodents, stimulation of MC4R causes a contraction in stay intake, since enmity of MC4R augmentations stay intake (8). MC4R rales twain sides of the essence intake/essence charge estimate (9).

Agouti akin peptide (AgRP), a MC4R rival, stimulated sustentation and caused stoutness (3). AgRP is the neuropeptide with 132 amino eager that are plain in the ARC of mice (10) and sheep (11). Using immunohistochemistry, AgRP-containing cell bodies were institute almost exclusively in the ARC, still their contrivanceions were select widely in the hypothalamus, most conspicuously in the PVN, ARC, dorsomedial nuclei, and the subsequent hypothalamic area (12). In some estimation, AgRP neurons are concerned in essence estimate (13). AgRP is an craving inducement (14) and augmentations duaccentuation the withdrawal of essence (15). Perfusion of monkey and rodents with AgRP augmentation stay intake (16). Intracerebroventricular (ICV) insertion of AgRP, augmentationd stay intake and prevented α-MSH in the rat (16). Mice with short in the MC4R countenance (17) or noble countenance of AgRP (18) were stout. Various hormones such as insulin, leptin and glucocorticoids could fluctuate AgRP countenance fixed on homeostasis arrangement (14). Neuropeptide Y (NPY) and the endogenous MC4R rival, AgRP, comport in the ARC, and twain exstrike orexigenic possessions (19). Ectopic AgRP countenance in the hypothalamus causes stoutness in the mouse, durationliness AgRP is plain by NPY neurons in the ARC (3) and NPY is plain by neurons that contrivance to great craving-predominant nuclei, including the PVN (3). NPY injected into the PVN is the most energetic accessible craving affront referableorious (3). The NPY neurons in the ARC are stimulated by decay, probably mediated by decreases in circulating leptin and insulin (which twain prevent these neurons), and co-operate to the augmentationd covet in essence arrears orders (3).

These results patronage the conjecture that the brain MC4R and AgRP is intimately concerned in the govern of stay intake and strike homeostatically to reframe disclaiming essence estimate. Therefore the lean of the give consider was to dare MC4R and AgRP mRNAs countenance in the ARC duaccentuation hanker promise malnutrition of womanly ovariectomized rats.

Material and modes

Sixteen womanly adult (3-4 months preceding) Sprague-Dawley rats (Rattus norvegicus) that weighed 200±20 g (neutralize ± SD) were randomly disunitedd from the Laboratory Animal Center of Shiraz University of Medical Sciences, Shiraz, Iran. They were close underneathneath governled latitude (22±2°C), dampness (60±6%) and bright (12 h bright to 12 h sombre ratio; brights on at 7:30 AM) orders. All tentative acts were carried quenched betwixt 12.00-2.00 pm and in acquiescence with the Animal Care Committee recommendations of the Shiraz University of Medical Sciences. Criterion rat satisfy (antecedently the set-on-foot of the consider) and breathe-into were spontaneously profitable to them. The rats were ovariectomized to depart the possessions of reproductive hormones duaccentuation the estrous cycle. The rats were anesthetized by ketamine (intraperitoneal insertion, 100 mg/kg, Woerden, Netherlands) and xylazine (intraperitoneal insertion, 7 mg/kg, Alfazyne, Woerden, Netherlands). They were ovariectomized through a ventral midline incision and succeeding a couple week repossession era, prefer acts were underneathtaken.

Criterion rat cheer contained 90% tame subject, 8% ash, 4.1% unshaped stout, 21.6% unshaped protein, 70.8% completion healthful nutrients (TDN), 0.4% calcium, 0.35% potassium and 0.1% sodium, which were measured fixed on AOAC, 1995. Couple weeks succeeding surgery, 12 rats were randomly disjoined into couple resembling assemblages and the principal assemblage were support with a entire ration (15 g/kg) of criterion rat cheer (regular cheer assemblage, n=6) and the other assemblage with a half ration (7.5 g/kg) of the principal assemblage (unpopular cheer assemblage, n=6) restraint 14 days and then were anesthetized with ether and were ethically killed. Four rats of govern assemblage were ethically killed couple weeks succeeding surgery (day 0).

The rats were decapitated, brains outside-delay dissected quenched, and the diencephalon was dissected quenched by an introductory garland individuality, introductory to the optic chiasm, and a subsequent garland slice at the subsequent hem of the mammillary bodies. To disunited ARC from other nuclei, a third garland slice was made through the average of the optic charge, righteous rostral to infundibulum (20). The specimens consisted of ARC and DMH were stored in liquescent nitrogen and then stored at -80°C. RNA race, DNase texture, cDNA body and referring-to developed-duration PCR act were manufactured as descriptive elsewhere (21). Primers were adapted with Allele ID 7 software restraint the allusion gene, AgRP (NM_033650.1) and MC4R (NM_013099.2). The rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (M32599) was used as allusion gene restraint basis regularization (Table 1).

Referring-to countenances of AgRP and MC4R fixed on the threshpreceding cycle (CT) mode were congenial restraint vital developed-duration PCR basis. Using Line-gene K software (22), CT restraint each pattern was congenial. Fpreceding countenance of the target mRNAs neutralize allusion appreciates was congenial by the equation 2-ΔΔCT (23), where ΔCT is secure by subtracting the inner govern (selfsame GAPDH CT appreciate) from the specific CT of the AgRP or MC4R. ΔΔCT was obtained by subtracting the ΔCT of each tentative pattern from that of the govern ovariectomized rats.

Normality of the basis on the referring-to countenance of AgRP and MC4R mRNAs were evaluated by Kolmogorov-Smirnov experience using SPSS rendeaccentuation 11.5 (SPSS Inc, Chicago, Illinois). Countenance of AgRP and MC4R mRNAs were compared betwixt assemblages using stubborn pattern t-test. Correspondence coefficient of their countenance was analyzed by Pearson correspondence experience. We considered P<0.05 as telling.

Results

Countenance of AgRP (P=0.048, Fig 1) and MC4R (P=0.027, Fig 2) mRNAs in the ARC of unpopular cheer assemblage of womanly ovariectomized rats was more than regular cheer assemblage. Stay-unpopular rats showed a 6.2 fpreceding augmentation in the countenance of AgRP mRNA in the ARC of the hypothalamus. Moreover, the countenance of MC4R mRNA augmentationd 6.7 durations in hanker promise stay-unpopular in similarity with regular sustentation womanly rats. A confident correspondence was observed betwixt countenance of AgRP and MC4R mRNAs in the ARC of womanly ovariectomized rats of twain cheer assemblages (r=0.99, P<0.001, Fig 3).

Discussion

Results of the give consider showed that hanker promise malnutrition augmentationd concomitantly countenance of AgRP and MC4R mRNAs in the ARC of rats. Consistent with our findings, secureing augmentationd AGRP countenance in rats (24). Moreover, hypothalamic AgRP mRNA countenance augmentationd in repartee to secureing in mice (25)., A 24-h secure resulted in a 2.2-fpreceding augmentationd AGRP mRNA countenance in the infundibular kernel in Japanese crouch in similarity with the ad-libitum-support say (26). A 4-fpreceding augmentation in the calculate of AGRP-ir cells in the hypothalamus tuberal portion was reported in stay-deprived doves and the totality of stay consumed by stay-deprived birds that were allowed to re-satisfy scant succeeding 5 ng of the MC3R and MC4R agonist MTII (27). Moreover, the AgRP countenance plane in unsupport fish was augmentationd at 3 and 4 h post-fasting than in support fish still did referable influence AgRP mRNA countenance succeeding 14 days secureing (28). In despicable object, succeeding secureing, countenance of MC4R and AgRP gene in brain were decreased and succeeding resustentation compaaccentuation with regular support governs augmentationd sharply (29). Upregulated AMPK strikeivity augmentations the AgRP countenance in repartee to secureing and decreases POMC peptides in intrauterine fetal augmentation unpopular newborn rats (30). Endogenous AgRP may be concerned in luteinizing hormindividual and prolactin surges duaccentuation decay, showing prefer attraction that the melanocortin rule is great restraint the surges of these hormonal in womanly rats (31). Leptin government decreased countenance of AgRP mRNA and augmentationd POMC mRNA planes inland baseline (25). Adrenalectomy decreased AGRP, neuropeptide gene countenance in the medial basal of the hypothalamus referablewithstanding the decline in plasma leptin and insulin concentrations which in other situations would augmentation these neuropeptides. Prefermore, glucocorticoids are referable required restraint secureing-induced uphabit of AGRP and NPY countenance (24). Adrenalectomy decreased AgRP and POMC countenance in the ARC in secureed and resupport animals, respectively (32). Duaccentuation decay, strikeivated autophagy in neurons of hypothalamus mobilized neuron-intrinsic lipids to produce detached stoutty eagers that augmentationd AgRP planes (33). Mice withdrawaling the countenance of MC4R plain hyperphagia resulting in early-onset stoutness (34). Fluctuates in the referring-to countenance plane of MC4R and AgRP mRNAs duaccentuation hanker promise malnutrition of rat involved a stimulatory role of MC4R and AgRP in predominant essence estimate in ARC of rat hypothalamus.

 

Acknowledgments

This examination was financially patronageed by the business-post of Student Scientific Affairs Management, Shiraz University, Shiraz, Iran.

Conflict of curiosity-behalf

There is no financial curiosity-behalf.

References

1.Martin WJ, McGowan E, Cashen DE, Gantert LT, Drisko JE, Hom GJ, et al. Strikeivation of melanocortin MC4 receptors augmentations erectile strikeivity in rats ex copula. Eur J Pharmacol. 2002;454(1):71-9.

2.Fredriksson R, Lagerström MC, Lundin L-G, Schiöth HB. The G-protein-coupled receptors in the cosmical genome restraintm five main families. Phylogenetic segregation, paralogon assemblages, and fingerprints. Mol Pharmacol. 2003;63(6):1256-72.

3.Williams G, Harrpreceding JA, Sliceler DJ, editors. The hypothalamus and the habit of essence homeostasis: lifting the lid on a bwithdrawal smack. Proceedings-Nutrition Society of London; 2000: Cambridge Univ Encroach.

4.Krasnow SM, Steiner RA. Physiological arrangements integrating metabolism and plurality. In: Neill JD, editor. Knobil and Neills Physiology of plurality. 3rd ed. St. Louis, MO, USA: Academic Encroach; 2006. p. 2587.

5.Mountjoy KG, Mortrud MT, Low MJ, Simerly RB, Cindividual RD. Localization of the melanocortin-4 receptor (MC4-R) in neuroendocrine and autonomic govern circuits in the brain. Mol Endocrinol. 1994;8(10):1298-308.

6.Vergoni AV, Bertolini A, Wikberg JES, Schiöth HB. Exceptive melanocortin MC4 receptor blockage reduces immobilization stress-induced anorexia in rats. Eur J Pharmacol. 1999;369(1):11-5.

7.Benoit SC, Schwartz MW, Lachey JL, Hagan MM, Rushing PA, Blake KA, et al. A innovating exceptive melanocortin-4 receptor agonist reduces stay intake in rats and mice withquenched conceding aversive consequences. J Neurosci. 2000;20(9):3442-8.

8.Koegler FH, Grove KL, Schiffmacher A, Smith MS, Cameron JL. Accessible melanocortin receptors mediate fluctuates in stay intake in the rhesus macaque. Endocrinology. 2001;142(6):2586-92.

9.Balthasar N. Genetic disindividuality of neuronal pathways governling essence homeostasis. Stoutness. 2006;14(S8):222S-7S.

10.Shutter JR, Graham M, Kinsey AC, Scully S, Lüthy R, Stark KL. Hypothalamic countenance of ART, a innovating gene akin to agouti, is up-regulated in rich and diabetic mutant mice. Genes Dev. 1997;11:593-602.

11.Jafarzadeh Shirazi MR, Tamadon A, Namavar MR. Cocountenance of gonadotropin preventory hormindividual with Agouti-akin peptide in the neurons of arcuate kernel of ewe hypothalamus. Physiol Pharmacol. 2011;15(2):201-9.

12.Légrádi G, Lechan RM. Agouti-akin protein containing strength promiseinals innervate thyrotropin-releasing hormindividual neurons in the hypothalamic paraventricular kernel. Endocrinology. 1999;140(8):3643-52.

13.Luquet S, Perez FA, Hnasko TS, Palmiter RD. NPY/AgRP Neurons Are Essential restraint Sustentation in Adult Mice still Can Be Ablated in Neonates. Science. 2005;310(5748):683-5.

14.Stütz AM, Morrison CD, Argyropoulos G. The Agouti-akin protein and its role in essence homeostasis. Peptides. 2005;26(10):1771-81.

15.Hahn TM, Breininger JF, Baskin DG, Schwartz MW. Cocountenance of Agrp and NPY in secureing-activated hypothalamic neurons. Nat Neurosci. 1998;1:271-2.

16.Rossi M, Kim MS, Morgan DGA, Small CJ, Edwards CMB, Sunter D, et al. A C-terminal morsel of Agouti-akin protein augmentations sustentation and antagonizes the issue of alpha-melanocyte pungent hormindividual in vivo. Endocrinology. 1998;139(10):4428-31.

17.Huszar D, Lynch CA, Fairchild-Huntress V, Dunmore JH, Fang Q, Berkemeier LR, et al. Targeted disengagement of the melanocortin-4 receptor results in stoutness in mice. Cell. 1997;88(1):131-41.

18.Ollmann MM, Wilson BD, Yang Y-K, Kerns JA, Chen Y, Gantz I, et al. Enmity of accessible melanocortin receptors in vitro and in vivo by agouti-akin protein. Science. 1997;278(5335):135-8.

19.Broberger C, Johansen J, Johansson C, Schalling M, Hökfelt T. The neuropeptide Y/agouti gene-akin protein (AGRP) brain circuitry in regular, anorectic, and monosodium glutamate-treated mice. Proc Natl Acad Sci U S A. 1998;95(25):15043-8.

20.Salehi MS, Namavar MR, Jafarzadeh Shirazi MR, Rahmanifar F, Tamadon A. A unblended technique restraint disengagement of the anteroventral periventricular and arcuate nuclei in the rat hypothalamus. Anatomy. 2013:In encroach.

21.Salehi MS, Jafarzadeh Shirazi MR, Zamiri MJ, Pazhoohi F, Namavar MR, Niazi A, et al. Hypo-thalamic countenance of KiSS1 and RFamide-akin Peptide-3 mRNAs duaccentuation the estrous cycle of rats. Int J Fertil Steril. 2013;6(4):304-9.

22.Larionov A, Krause A, Miller W. A criterion incurvation fixed mode restraint referring-to developed duration PCR basis processing. BMC Bioinformatics. 2005;6(1):62.

23.Livak KJ, Schmittgen TD. Segregation of referring-to gene countenance basis using developed-duration vital PCR and the 2(-Delta Delta C(T)) mode. Modes. 2001;25(4):402-8.

24.Savontaus E, Conwell IM, Wardlaw SL. Possessions of adrenalectomy on AGRP, POMC, NPY and CART gene countenance in the basal hypothalamus of support and secureed rats. Brain Res. 2002;958(1):130-8.

25.Ziotopoulou M, Erani DM, Hileman SM, Bjørbaek C, Mantzoros CS. Unlike leptin, ciliary neurotrophic rudiment does referable contradiction the decay-induced fluctuates of serum corticosterindividual and hypothalamic neuropeptide planes still induces countenance of hypothalamic preventors of leptin signaling. Diabetes. 2000;49(11):1890-6.

26.Phillips-Singh D, Li Q, Takeuchi S, Ohkubo T, Sharp PJ, Boswell T. Secureing differentially rales countenance of agouti-akin peptide, pro-opiomelanocortin, prepro-orexin, and vasoactive intestinal polypeptide mRNAs in the hypothalamus of Japanese crouch. Cell Web Res. 2003;313(2):217-25.

27.Strader AD, Schiöth HB, Buntin JD. The role of the melanocortin rule and the melanocortin-4 receptor in accentuation dove (Streptopelia risoria) sustentation conduct. Brain Res. 2003;960(1):112-21.

28.Wei R, Yuan D, Wang T, Zhou C, Lin F, Chen H, et al. Characterization, web classification and habit of agouti-akin protein (AgRP) in a cyprinid fish (Schizothorax prenanti). Gene. 2013;527(1):193-200.

29.Wan Y, Zhang Y, Ji P, Li Y, Xu P, Sun X. Molecular characterization of CART, AgRP, and MC4R genes and their countenance with secureing and re-sustentation in despicable object (Cyprinus objectio). Mol Biol Rep. 2012;39(3):2215-23.

30.Fukami T, Sun X, Li T, Desai M, Ross MG. Arrangement of programmed stoutness in intrauterine fetal augmentation unpopular offspring: paradoxically enhanced craving stimulation in support and secureing says. Reprod Sci. 2012;19(4):423-30.

31.Schioth HB, Kakizaki Y, Kohsaka A, Suda T, Watanobe H. Agouti-akin peptide prevents steroid-induced luteinizing hormindividual and prolactin surges in womanly rats. Neuroreport. 2001;12(4):687-90.

32.Uchoa ET, Silva LE, de Castro M, Antunes-Rodrigues J, Elias LLK. Glucocorticoids are required restraint meal-induced fluctuates in the countenance of hypothalamic neuropeptides. Neuropeptides. 2012;46(3):119-24.

33.Singh R. Autophagy in the govern of stay intake. Adipocyte. 2012;1(2):75-9.

34.Cui H, Lutter M. The countenance of MC4Rs in D1R neurons rales stay intake and locomotor sensitization to cocaine. Genes Brain Behav. 2013;12(6):658-65.

Table 1: Sequences of developed-duration PCR primers used to evaluate referring-to countenance of AgRP and MC4R genes in the rat

Amplicon extension (bp)

Primer sequence

Primer

181

5` TGGGTGTCATAAGCCTGTTGG 3`

5` GCGTCCGTGTCCGTACTG 3`

MC4R-F

MC4R-R

189

5` TGAAGAAGACAGCAGCAGACC 3`

5` TGAAGAAGCGGCAGTAGCAC 3`

AgRP-F

AgRP-R

112

5` AAGAAGGTGGTGAAGCAGGCATC 3`

5` CGAAGGTGGAAGAGTGGGAGTTG 3`

GAPDH-F

GAPDH-R

Fig 1. Neutralize (± criterion untruth) of the referring-to countenance of agouti-akin peptide (AgRP) mRNAs in the arcuate kernel (n=6) duaccentuation hanker promise malnutrition in womanly ovariectomized rats. Different lore evince telling estrangement (P<0.05).

Fig 2. Neutralize (± criterion untruth) of the referring-to countenance of melanocortin-4 receptor (MC4R) mRNAs in the arcuate kernel (n=6) duaccentuation hanker promise malnutrition in womanly ovariectomized rats. Different lore evince telling estrangement (P<0.05).

Fig 3. Correspondence of the referring-to countenance of agouti-akin peptide (AgRP) and melanocortin-4 receptor (MC4R) mRNAs in the arcuate kernel (n=6) in womanly ovariectomized rats.

1

HomeworkAceTutors
Calculate your paper price
Pages (550 words)
Approximate price: -

Why Work with Us

Top Quality and Well-Researched Papers

We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.

Professional and Experienced Academic Writers

We have a team of professional writers with experience in academic and business writing. Many are native speakers and able to perform any task for which you need help.

Free Unlimited Revisions

If you think we missed something, send your order for a free revision. You have 10 days to submit the order for review after you have received the final document. You can do this yourself after logging into your personal account or by contacting our support.

Prompt Delivery and 100% Money-Back-Guarantee

All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.

Original & Confidential

We use several writing tools checks to ensure that all documents you receive are free from plagiarism. Our editors carefully review all quotations in the text. We also promise maximum confidentiality in all of our services.

24/7 Customer Support

Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.

Try it now!

Calculate the price of your order

Total price:
$0.00

How it works?

Follow these simple steps to get your paper done

Place your order

Fill in the order form and provide all details of your assignment.

Proceed with the payment

Choose the payment system that suits you most.

Receive the final file

Once your paper is ready, we will email it to you.

Our Services

No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.

Essays

Essay Writing Service

No matter what kind of academic paper you need and how urgent you need it, you are welcome to choose your academic level and the type of your paper at an affordable price. We take care of all your paper needs and give a 24/7 customer care support system.

Admissions

Admission Essays & Business Writing Help

An admission essay is an essay or other written statement by a candidate, often a potential student enrolling in a college, university, or graduate school. You can be rest assurred that through our service we will write the best admission essay for you.

Reviews

Editing Support

Our academic writers and editors make the necessary changes to your paper so that it is polished. We also format your document by correctly quoting the sources and creating reference lists in the formats APA, Harvard, MLA, Chicago / Turabian.

Reviews

Revision Support

If you think your paper could be improved, you can request a review. In this case, your paper will be checked by the writer or assigned to an editor. You can use this option as many times as you see fit. This is free because we want you to be completely satisfied with the service offered.

5 to 20% OFF Discount!!

For all your orders at Homeworkacetutors.com get discounted prices!
Top quality & 100% plagiarism-free content.